diff --git a/python/genvarloader/_dataset/_svar2_haps.py b/python/genvarloader/_dataset/_svar2_haps.py index 0ef2ed4f..3278e410 100644 --- a/python/genvarloader/_dataset/_svar2_haps.py +++ b/python/genvarloader/_dataset/_svar2_haps.py @@ -31,6 +31,7 @@ from typing import TYPE_CHECKING, Any, Literal, cast import numpy as np +from genoray._contigs import ContigNormalizer from genoray._types import POS_TYPE, V_IDX_TYPE from numpy.typing import NDArray from seqpro.rag import Ragged @@ -200,6 +201,15 @@ class Svar2Haps(Haps[_H]): Populated from ``SparseVar2.available_fields``. These keys are additionally advertised in ``available_var_fields`` so users can request them via ``var_fields``. """ + _ds_to_store: list[str | None] = field(init=False) + """``ds_contigs`` mapped to the store's spelling, parallel to ``ds_contigs``. + + The dataset and its .svar2 store may name contigs differently (e.g. a UCSC-named + ``chr1`` reference/GTF over an Ensembl-named ``1`` store) — the write path + reconciles the two, so the read path must too. ``None`` marks a dataset contig + with no equivalent in the store; that is only an error if such a contig is + actually queried, so it is raised lazily by :meth:`_store_contig`. + """ def __post_init__(self): # Deliberately does NOT call Haps.__post_init__ (that reads an SVAR1 @@ -209,6 +219,22 @@ def __post_init__(self): self.available_var_fields = ["alt", "ilen", "start"] + [ k for k in self.store_fields if k not in _BUILTIN_VAR_FIELDS ] + # Resolve once per contig at open, not once per query. + self._ds_to_store = ContigNormalizer(self.store_contigs).norm(self.ds_contigs) + + def _store_contig(self, ci: int) -> str: + """Return the .svar2 store's spelling of dataset contig index ``ci``. + + The read-bound Rust kernels look contigs up in the store's own keyspace, so + they must be handed the store's spelling rather than the dataset's. + """ + contig = self._ds_to_store[ci] + if contig is None: + raise ValueError( + f"Dataset contig {self.ds_contigs[ci]!r} has no equivalent in the" + f" .svar2 store, whose contigs are {self.store_contigs}." + ) + return contig # ---- construction ---- @@ -462,7 +488,7 @@ def _reconstruct_spliced( out, g_bounds, self.store, - self.ds_contigs[ci], + self._store_contig(ci), gi[0], gi[1], gi[2], @@ -509,7 +535,7 @@ def _haplotype_diffs( gi = self._gather_inputs(r_q[qsel], si_q[qsel], regions[qsel], ploidy) d = hap_diffs_from_svar2_readbound( self.store, - self.ds_contigs[ci], + self._store_contig(ci), gi[0], gi[1], gi[2], @@ -614,7 +640,7 @@ def get_haps_and_shifts( g_total = int(hap_lengths[qsel].sum()) g_data, g_off = reconstruct_haplotypes_from_svar2_readbound( self.store, - self.ds_contigs[ci], + self._store_contig(ci), gi[0], gi[1], gi[2], @@ -718,7 +744,7 @@ def realign_track_block( g_total = int(track_ofsts_g[-1]) out_data, out_off = shift_and_realign_tracks_from_svar2_readbound( self.store, - self.ds_contigs[ci], + self._store_contig(ci), gi[0], gi[1], gi[2], @@ -855,7 +881,7 @@ def measure_variant_payload( pos, ilen, alt_bytes, str_off, var_off, field_bufs, field_isizes = ( decode_variants_from_svar2_readbound( self.store, - self.ds_contigs[ci], + self._store_contig(ci), gi[0], gi[1], gi[2], @@ -947,7 +973,7 @@ def _reconstruct_variants( pos, ilen, alt_bytes, str_off, var_off, field_bufs, field_isizes = ( decode_variants_from_svar2_readbound( self.store, - self.ds_contigs[ci], + self._store_contig(ci), gi[0], gi[1], gi[2], @@ -1092,7 +1118,7 @@ def _reconstruct_variant_windows( pos, ilen, alt_bytes, str_off, var_off, field_bufs, field_isizes = ( decode_variants_from_svar2_readbound( self.store, - self.ds_contigs[ci], + self._store_contig(ci), gi[0], gi[1], gi[2], diff --git a/tests/dataset/test_svar2_contig_naming.py b/tests/dataset/test_svar2_contig_naming.py new file mode 100644 index 00000000..c6beedc9 --- /dev/null +++ b/tests/dataset/test_svar2_contig_naming.py @@ -0,0 +1,112 @@ +"""Regression test for #336: SVAR2 read path must normalize contig naming. + +A dataset's contigs come from its BED (``_write._prep_bed``: ``natsorted(bed["chrom"] +.unique())``), while a ``.svar2`` store carries whatever spelling its source VCF used. +The two are allowed to differ — a UCSC-named (``chr1``) BED over an Ensembl-named +(``1``) store is a supported arrangement, and ``gvl.write`` reconciles them. + +Before the fix, only the *write* path normalized: ``Svar2Haps`` passed +``ds_contigs[ci]`` straight into the read-bound Rust kernels, which look contigs up +in the store's own keyspace. So such a dataset built successfully and then raised +``ValueError: contig chr1 not in store`` on the first read. +""" + +from __future__ import annotations + +import subprocess +from dataclasses import replace +from pathlib import Path + +import polars as pl +import pytest + +import genvarloader as gvl + +# Same 40 bp reference and variants as the other svar2 fixtures, but named "1" +# (Ensembl) rather than "chr1" (UCSC), so the store's keyspace differs from the BED's. +_REF = "ACAGTACATGGGTACTAGCTAGGCTAACCGGTTAACCGGT" +_VCF = """\ +##fileformat=VCFv4.2 +##contig= +##FORMAT= +#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO\tFORMAT\tS0\tS1 +1\t3\t.\tA\tG\t.\t.\t.\tGT\t1|0\t0|0 +1\t7\t.\tC\tCAT\t.\t.\t.\tGT\t0|1\t1|1 +1\t12\t.\tGTA\tG\t.\t.\t.\tGT\t1|1\t0|1 +""" + + +@pytest.fixture(scope="module") +def ensembl_svar2_store(tmp_path_factory) -> Path: + """A ``.svar2`` store whose only contig is spelled ``1``.""" + from genoray import _core + + d = tmp_path_factory.mktemp("svar2_contig_naming") + ref = d / "ref.fa" + ref.write_text(f">1\n{_REF}\n") + subprocess.run(["samtools", "faidx", str(ref)], check=True) + + vcf = d / "in.vcf" + vcf.write_text(_VCF) + bcf = d / "in.bcf" + subprocess.run(["bcftools", "view", "-Ob", "-o", str(bcf), str(vcf)], check=True) + subprocess.run(["bcftools", "index", str(bcf)], check=True) + + out = d / "store.svar2" + _core.run_conversion_pipeline( + str(bcf), + str(ref), + ["1"], + str(out), + ["S0", "S1"], + 25_000, + 2, + 1, + 8 * 1024 * 1024, + ) + assert (out / "meta.json").exists(), "conversion did not finish" + return out + + +@pytest.fixture(scope="module") +def chr_named_dataset(ensembl_svar2_store: Path, tmp_path_factory) -> Path: + """A dataset whose regions are ``chr1`` over the ``1``-named store.""" + from genoray import SparseVar2 + + bed = pl.DataFrame( + {"chrom": ["chr1", "chr1"], "chromStart": [0, 5], "chromEnd": [20, 15]} + ) + out = tmp_path_factory.mktemp("svar2_contig_naming_ds") / "ds.gvl" + # The write path already reconciles chr1 <-> 1; this must succeed. + gvl.write( + out, bed, variants=SparseVar2(ensembl_svar2_store), samples=None, overwrite=True + ) + return out + + +def test_svar2_read_normalizes_contig_naming(chr_named_dataset: Path): + """A chr-named dataset over an Ensembl-named .svar2 store must be readable.""" + ds = gvl.Dataset.open(chr_named_dataset).with_seqs("variants") + + # The premise: the dataset and its store really do disagree on spelling. + assert ds._seqs.ds_contigs == ["chr1"] + assert ds._seqs.store_contigs == ["1"] + + # Raised `ValueError: contig chr1 not in store` before the fix. + assert ds[0] is not None + + +def test_svar2_unmapped_contig_names_both_spellings(chr_named_dataset: Path): + """A dataset contig with no store equivalent raises, naming both spellings. + + Resolution is lazy: an unmappable contig is only an error when that contig is + actually queried, so building the resolution table at open must not itself raise. + """ + ds = gvl.Dataset.open(chr_named_dataset).with_seqs("variants") + + # replace() re-runs __post_init__, so the resolution table is rebuilt. + haps = replace(ds._seqs, ds_contigs=["chrZ"]) + assert haps._ds_to_store == [None] # built without raising + + with pytest.raises(ValueError, match=r"chrZ.*no equivalent"): + haps._store_contig(0)